Grapevine Pinot gris virus (GPGV) is a new member of the genus Trichovirus in the family Betaflexiviridae. The virus was first discovered from an Italian Pinot gris grapevine (Vitis vinifera) (Giampetruzzi et al. 2012). Since then, GPGV has been reported in symptomatic and asymptomatic plants of other cultivars in many countries (Saldarelli et al. 2015). Biological and molecular assays using Pinot gris and Traminer grapevines suggested that there may be symptomatic and asymptomatic GPGV isolates. To address the possible presence and prevalence of GPGV in the collections of the Foundation Plant Services (FPS, University of California, Davis), 2,014 vines from the collection were screened, including 23 vines of Pinot gris. This collection is the source of all certified grapevine plants produced in California, and the virus status of mother vines in it is of great importance for the U.S. wine industry. Total RNA was extracted from leaf petiole tissue using the MagMax 96 Viral RNA isolation kit with the MagMax Express-96 magnetic particle processor (Thermo Fisher Scientific, USA). The RNA was analyzed for the presence of the GPGV genome by real-time qRT-PCR (forward ACCACAATGGTGAAGTGTCATGA; probe FAM-TCTTTTAATCCTTCCCTGCCG; reverse ACGAAAAGTCATTAACTTTATGTCA). Among all the vines tested, only one asymptomatic vine ‘Touriga Nacional’ was positive for GPGV. This vine had been imported from Portugal in 1981, eventually receiving tissue culture virus therapy, clearing quarantine tests, and being planted in the FPS collection in 2001. To confirm the qRT-PCR results, fresh leaf tissue samples were collected from all 6 vines of this selection in the collection, and total RNA isolated from each and screened by RT-PCR. The reaction used two sets of GPGV-specific primer pairs as described by Saldarelli et al. (2015). Of the 6 plants tested, only the plant which tested positive previously produced specific DNA fragments of the expected sizes (588 bp and 525 bp, respectively). PCR products were directly sequenced and found 96 to 99% identical with GPGV sequences currently available in GenBank. To further confirm the result, fresh leaf tissue was collected from the positive Touriga Nacional vine, total nucleic acid was extracted and analyzed by HTS at the SeqMatic LLC (Fremont, CA) sequencing facility using half lane on the Illumina NextSEquation 500 platform. The analysis generated approximately 410 million Illumina reads (∼75 nt in length) of which more than 209,000 reads were mapped to the GPGV genome. The Californian GPGV isolate “GPGV-TN” (7,197 nt, KT894101) shared 93 to 99% identity with other GPGV isolates available in the GenBank. No other viruses were found in the sample; however, BLAST analysis showed the presence of Grapevine yellow speckle viroid 1. To our knowledge, this is the first report of GPGV in the United States. There is no indication of active spread of the virus as assessed by specific qRT-PCR analysis of the 20 vines surrounding the infected vine. Given this very low prevalence of GPGV in the FPS collection, confined to a single plant of one cultivar, the risk of GPGV spread in commercial vineyards could be considered low. However, a larger scale survey of commercial vineyards is needed to determine the prevalence of GPGV in California. Further research also should be conducted to evaluate the effect of GPGV on vine performance and wine quality. © 2016, American Phytopathological Society. All rights reserved.
