The kinetics of triplex formation between the oligonucleotides d(AGGGAGG-GAGGAAGGGAGGG) (20AG). d(TGGGTGCGTGGTTGGGTGGG) (20GT) and a 29-bp polypurine-polpyrimidine sequence located in the c-Ki-ras promoter (D) was studied bq electrophoretic experiments in 50 mM Tris/acetate, FH 7.4, 50 mM NaCl, 5 mM MgCl2. Rates of triple formation were determined at three different temperatures (20 degrees C, 37 degrees C and 15 degrees C), under pseudo-first order conditions obtained by using the triples-forming oligonucleotide (TFO) 500-fold in excess over the target duplex (5 nM). Measurements at TFO/target ratios of 20 anti 100 were also carried out. At 37 degrees C the pseudo first-order constants, k(obs), were 18.9 +/- 10(-5) s(-1) for 20AG and 13.0 x 10(-5) s(-1) for 20GT, yielding association half-lives of 1 h and 1.5 h, respectively. Second-order association constants were found to be in the order of 10(2) M-1 s(-1): these are slightly lower if compared with those measured for triplex formation by polypyrimidine (C, T) oligonucleotides (10(3) M-1 s(-1)) [Maher. L. J., Dervan. P. B. & Wolf, B. J. (1990) Biochemistry 29, 8820-8826; Xodo, L. E. (1995) Eur. J. Biochem. 228, 918-926: Bates, P. J., Dosanjh, H. S., Jenkins, T. C., Laughton, C. A. & Neidle. S. (1995) Nucleic Acids Res. 23, 3627-3632] but dramatically lower when compared with duplex recombination from complementary strands (10(6) M-1 s(-1)) [Craig, M. E., Crothers, D. M. & Doty, P. (1971) J. Mol. Biol. 62, 383-401; Porschke, D. & Eigen, M. (1971) J. Mol. Biol. 361-381]. Dissociation rate constants, k(-1), were indirectly obtained from equilibrium constants (K-d) and found to be, at 37 degrees C, 6.7 x 10(-7) s(-1) and 5.4 x 10(-6) s(-1) for 20AG and 20GT, respectively. From the rate constants obtained at 20 degrees C, 37 degrees C and 45 degrees C we estimated activation energies of triplex formation between D plus 20 AG and D plus 20GT of respectively 134 +/- 29 and 88 +/- 21 kJ/mol. Moreover, the activation energies for the reaction of tripler dissociation were 385 +/- 50 kJ/mol for 20AG and 330 +/- 42 kJ/mol for 20GT. Decreasing the TFO/target ratio from 500 to 100 or 20, we observed a concomitant decrease of the association rate, in keeping with the finding that triples formation occurs through a bimolecular process. We found that the effect of salt on triplex formation is rather complex, as, the addition of 2 mM spermidine boosted the binding rate of 20GT, but slightly reduced that of 20AG: the increase of NaCl from 50 mM to 100 mM or 150 mM decreased the rate of tripler formation. Finally, the biological implications of the kinetic behaviour exhibited by the two triplex-forming oligonucleotides specific for the c-Ki-ras promoter are discussed.