Characterisation of oil degrading bacteria from tailored compost containing crude oil sludge

In the present study, different bacteria with polycyclic aromatic hydrocarbon (PAH)-degrading capabilities were isolated from compost prepared from oil sludge and animal manures. These bacteria were isolated on a mineral base medium and mineral salt agar plates. A total of 31 morphologically distinct isolates were carefully selected from 5 different compost treatments for identification using polymerase chain reaction (PCR) of the 16S rRNA gene with specific primers (16S-P1 PCR (5'AGAGTTTGATCCTGGCTCAG3') and 16S-P2 PCR (5'AAGGAGGTGATCCAGCCGCA3'). The amplicons were sequenced using 16S-PA SEQ (5/CTACGGGAGGCAGCAG3/) and sequences were compared with the known nucleotides from the GenBank. The phylogenetic analyses of the isolates showed that they belong to 3 different clades: Firmicutes, Proteobacteria and Actinobacteria. The bacteria identified were closely related to the genera Bacillus, Arthrobacter, Staphylococcus, Brevibacterium, Variovorax, Paenibacillus, Ralstonia and Geobacillus. The results showed that Bacillus species were predominant in all composts. Based on the results of the degradation of the PAH in the composts and results of previous studies on bacterial degradation of hydrocarbons in oil, the characteristics of these bacterial isolates suggests that they may be responsible for the breakdown of PAH of different mol wt in the composts. Thus, they may be potentially useful for bioremediation of oil sludge during compost bioremediation.